nested pcr Search Results


nest 96 well pcr plate  (Opentrons Labworks)
93
Opentrons Labworks nest 96 well pcr plate
Nest 96 Well Pcr Plate, supplied by Opentrons Labworks, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/NEST+96-Well+PCR+Plate%2C+Full+Skirt/pmc12575655-289-35-45
Average 93 stars, based on 1 article reviews
nest 96 well pcr plate - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier
nested pcr gotaq® dna polymerase  (Promega)
90
Promega nested pcr gotaq® dna polymerase
Nested Pcr Gotaq® Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr+gotaq++dna+polymerase/10__14710_slash_buloma__v5i2__15734-56-8-16
Average 90 stars, based on 1 article reviews
nested pcr gotaq® dna polymerase - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested pcr  (Oxford Nanopore)
90
Oxford Nanopore nested pcr
Nested Pcr, supplied by Oxford Nanopore, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr/ppr0087649-63-9-23
Average 90 stars, based on 1 article reviews
nested pcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested–pcr  (Amplimedical SPA)
90
Amplimedical SPA nested–pcr
Nested–Pcr, supplied by Amplimedical SPA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr/10__1111_slash_j__1469___0691__2007__01733__x-15505-8-11
Average 90 stars, based on 1 article reviews
nested–pcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested pcr (in-house)  (Organon Teknika Corporation LLC)
90
Organon Teknika Corporation LLC nested pcr (in-house)
Nested Pcr (In House), supplied by Organon Teknika Corporation LLC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr++in+house+/pmc05189866-0-31-34
Average 90 stars, based on 1 article reviews
nested pcr (in-house) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested pcr  (UniTaq Bio)
90
UniTaq Bio nested pcr
Nested Pcr, supplied by UniTaq Bio, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr/us11305282-344-45-53
Average 90 stars, based on 1 article reviews
nested pcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
hemi-nested rt-pcr  (Franka Emika GmbH)
90
Franka Emika GmbH hemi-nested rt-pcr
Hemi Nested Rt Pcr, supplied by Franka Emika GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/hemi+nested+rt+pcr/10__2754_slash_avb200978020273-14-1-25
Average 90 stars, based on 1 article reviews
hemi-nested rt-pcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested pcr-based assay rapid bap-mtb  (AsiaGen Corporation)
90
AsiaGen Corporation nested pcr-based assay rapid bap-mtb
Nested Pcr Based Assay Rapid Bap Mtb, supplied by AsiaGen Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr+based+assay+rapid+bap+mtb/10__1128_slash_jcm__42__10__4599___4603__2004-4-86-91
Average 90 stars, based on 1 article reviews
nested pcr-based assay rapid bap-mtb - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested pcr primers for host hypoxanthine phosphoriboxyltransferase (hprt) cdna ( 25 )  (GeNOsys Inc)
90
GeNOsys Inc nested pcr primers for host hypoxanthine phosphoriboxyltransferase (hprt) cdna ( 25 )
Presence of vRNA in brains of V-1- and V-2-infected mice. Total RNA was prepared from brains of four individual mice infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host <t>HPRT</t> RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the <t>cDNA</t> synthesis.
Nested Pcr Primers For Host Hypoxanthine Phosphoriboxyltransferase (Hprt) Cdna ( 25 ), supplied by GeNOsys Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr+primers+for+host+hypoxanthine+phosphoriboxyltransferase++hprt++cdna+++25++/pmc00112321-63-28-39
Average 90 stars, based on 1 article reviews
nested pcr primers for host hypoxanthine phosphoriboxyltransferase (hprt) cdna ( 25 ) - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
generalized nested pcr assay  (Zoologix Inc)
90
Zoologix Inc generalized nested pcr assay
Presence of vRNA in brains of V-1- and V-2-infected mice. Total RNA was prepared from brains of four individual mice infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host <t>HPRT</t> RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the <t>cDNA</t> synthesis.
Generalized Nested Pcr Assay, supplied by Zoologix Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/generalized+nested+pcr+assay/pmc05557210-146-29-40
Average 90 stars, based on 1 article reviews
generalized nested pcr assay - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested-pcr  (CH Instruments)
90
CH Instruments nested-pcr
Presence of vRNA in brains of V-1- and V-2-infected mice. Total RNA was prepared from brains of four individual mice infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host <t>HPRT</t> RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the <t>cDNA</t> synthesis.
Nested Pcr, supplied by CH Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr/10__1590_slash_s1517___838246246220140110-17-0-15
Average 90 stars, based on 1 article reviews
nested-pcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier
nested pcr  (TATAA Biocenter AB)
90
TATAA Biocenter AB nested pcr
Presence of vRNA in brains of V-1- and V-2-infected mice. Total RNA was prepared from brains of four individual mice infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host <t>HPRT</t> RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the <t>cDNA</t> synthesis.
Nested Pcr, supplied by TATAA Biocenter AB, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/nested+pcr/nested+pcr/pm09929972-26-28-19
Average 90 stars, based on 1 article reviews
nested pcr - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


Presence of vRNA in brains of V-1- and V-2-infected mice. Total RNA was prepared from brains of four individual mice infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host HPRT RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the cDNA synthesis.

Journal:

Article Title: Role of Viral Persistence in Retaining CD8 + T Cells within the Central Nervous System

doi:

Figure Lengend Snippet: Presence of vRNA in brains of V-1- and V-2-infected mice. Total RNA was prepared from brains of four individual mice infected with either V-1 (A) or V-2 (B) at days 7, 11, 33, and 63 p.i. as indicated. Sequences from the viral N RNA and host HPRT RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the cDNA synthesis.

Article Snippet: Nested PCR primers for amplification of viral nucleocapsid (N) gene nucleotides 534 to 898 (GTCGCAAGCCAACAGGCCG and GGAGTCCTCTTTTGACGAGGC) and 548 to 858 (CCATGGCCGAGACTAGGACCTCT and CTGCCTGACTTCTTTGGCACT) as well as for host hypoxanthine phosphoriboxyltransferase (HPRT) cDNA ( 25 ) were purchased from Genosys Biotechnologies (The Woodlands, Tex.).

Techniques: Infection, Amplification, Nucleic Acid Electrophoresis, Marker

Presence of vRNA in spinal cords of V-1- and V-2-infected mice. Total RNA was prepared from spinal cords of four individual mice infected with either V-1 (A) or V-2 (B) at each of the indicated time points. Sequences from the viral N RNA and host HPRT RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the cDNA synthesis.

Journal:

Article Title: Role of Viral Persistence in Retaining CD8 + T Cells within the Central Nervous System

doi:

Figure Lengend Snippet: Presence of vRNA in spinal cords of V-1- and V-2-infected mice. Total RNA was prepared from spinal cords of four individual mice infected with either V-1 (A) or V-2 (B) at each of the indicated time points. Sequences from the viral N RNA and host HPRT RNA (A and B) were amplified and analyzed by gel electrophoresis. PCR products from days 33 and 63 p.i. were further amplified using a nested set of primers for the viral N gene (C). M, marker; N, naive control mouse; −, no RNA used during the cDNA synthesis.

Article Snippet: Nested PCR primers for amplification of viral nucleocapsid (N) gene nucleotides 534 to 898 (GTCGCAAGCCAACAGGCCG and GGAGTCCTCTTTTGACGAGGC) and 548 to 858 (CCATGGCCGAGACTAGGACCTCT and CTGCCTGACTTCTTTGGCACT) as well as for host hypoxanthine phosphoriboxyltransferase (HPRT) cDNA ( 25 ) were purchased from Genosys Biotechnologies (The Woodlands, Tex.).

Techniques: Infection, Amplification, Nucleic Acid Electrophoresis, Marker